ClinVar Genomic variation as it relates to human health
NM_003924.4(PHOX2B):c.741_755del (p.Ala256_Ala260del)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_003924.4(PHOX2B):c.741_755del (p.Ala256_Ala260del)
Variation ID: 196371 Accession: VCV000196371.36
- Type and length
-
Deletion, 15 bp
- Location
-
Cytogenetic: 4p13 4: 41745997-41746011 (GRCh38) [ NCBI UCSC ] 4: 41748014-41748028 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Oct 2, 2016 May 12, 2024 Feb 1, 2024 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_003924.4:c.741_755del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_003915.2:p.Ala256_Ala260del NM_003924.3:c.741_755delCGCGGCAGCGGCGGC NC_000004.12:g.41746005_41746019del NC_000004.11:g.41748022_41748036del NG_008243.1:g.7960_7974del NG_053075.1:g.131_145del LRG_513:g.7960_7974del - Protein change
- Other names
- -
- Canonical SPDI
- NC_000004.12:41745996:GCCGCCGCTGCCGCGGCCGCCGC:GCCGCCGC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
LOC110011216 | - | - | - | GRCh38 | - | 129 |
PHOX2B | - | - |
GRCh38 GRCh37 |
745 | 1081 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Benign/Likely benign (5) |
criteria provided, multiple submitters, no conflicts
|
Apr 14, 2023 | RCV000177186.27 | |
Benign (1) |
criteria provided, single submitter
|
Jan 26, 2024 | RCV000231391.20 | |
Benign/Likely benign (2) |
criteria provided, multiple submitters, no conflicts
|
Oct 26, 2020 | RCV000574621.11 | |
Likely benign (5) |
criteria provided, multiple submitters, no conflicts
|
Feb 1, 2024 | RCV001579675.18 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Likely benign
(-)
|
criteria provided, single submitter
Method: clinical testing
|
NOT SPECIFIED
Affected status: unknown
Allele origin:
germline
|
PreventionGenetics, part of Exact Sciences
Accession: SCV000309889.1
First in ClinVar: Oct 02, 2016 Last updated: Oct 02, 2016 |
|
|
Likely benign
(Dec 17, 2014)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: unknown
Allele origin:
germline
|
Eurofins Ntd Llc (ga)
Accession: SCV000229021.5
First in ClinVar: Jun 28, 2015 Last updated: May 03, 2018 |
Number of individuals with the variant: 1
Sex: mixed
|
|
Benign
(Dec 14, 2016)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: not provided
Allele origin:
germline
|
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Accession: SCV000731335.2
First in ClinVar: Apr 09, 2018 Last updated: May 03, 2018 |
Comment:
p.Ala256_Ala260del (also known as p.Ala241[15]) in exon 3 of PHOX2B: This varian t is common in the general population and therefore believed to be benign … (more)
p.Ala256_Ala260del (also known as p.Ala241[15]) in exon 3 of PHOX2B: This varian t is common in the general population and therefore believed to be benign (Gener eviews: www.ncbi.nlm.nih.gov/books/NBK1427/#ondine.Molecular_Genetics). It was d etected in 2% (63/3266) of East Asian chromosomes, including 2 homozygotes, by t he Exome Aggregation Consortium (ExAC, http://exac.broadinstitute.org; dbSNP rs7 75006915). This variant represents a deletion of 5 alanine amino acids within a repeat sequence in this gene, for a total of 15 total repeats (The predominant n ormal allele contains 20 repeats). (less)
Number of individuals with the variant: 2
|
|
Likely benign
(Aug 11, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: no
Allele origin:
germline
|
Genetic Services Laboratory, University of Chicago
Accession: SCV002064874.1
First in ClinVar: Jan 29, 2022 Last updated: Jan 29, 2022 |
|
|
Benign
(Apr 14, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: unknown
Allele origin:
germline
|
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV003929342.1
First in ClinVar: Jun 03, 2023 Last updated: Jun 03, 2023 |
Comment:
Variant summary: PHOX2B c.741_755del15 (p.Ala256_Ala260del) results in an in-frame deletion that is predicted to remove 5 amino acids from the encoded protein. This variant is … (more)
Variant summary: PHOX2B c.741_755del15 (p.Ala256_Ala260del) results in an in-frame deletion that is predicted to remove 5 amino acids from the encoded protein. This variant is located to a poly-alanine repeat region, where the major allele contains a 20 alanine stretch, and this variant removes 5 alanines. The variant allele was found at a frequency of 0.0033 in 145318 control chromosomes in the gnomAD database, including 1 homozygote. The observed variant frequency is approximately 4000-fold of the estimated maximal expected allele frequency for a pathogenic variant in PHOX2B causing Neuroblastoma, Susceptibility Type, 2 phenotype (8.3e-07), strongly suggesting that the variant is benign. The variant, c.741_755del15 or equivalent protein level changes, have been reported in the literature in individuals affected with Neuroblastoma (e.g. Raabe_2008), however without providing evidence for causality. Similar 5 alanine deletion variants have also been reported in patients affected with Hirschsprung disease, with some of them noting mild neonatal respiratory disorders (Di Zanni_2017). Authors of this study also reported experimental evidence evaluating the impact of contractions of the polyalanine tract, and demonstrated that the -5Ala variant resulted in ~95% transactivation response compared to the WT on RET promoter, while greater contractions (-7Ala and -13Ala) resulted in significantly lower transactivation values (Di Zanni_2017), therefore authors of this study proposed that contractions of the 20 alanine stretch of the PHOX2B gene could increase the susceptibility to Hirschsprung disease (with mild neonatal respiratory disorders). Seven clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation. All laboratories classified the variant as benign/likely benign. Based on the evidence outlined above, the variant was classified as benign. (less)
|
|
Likely benign
(Nov 03, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: not provided
Allele origin:
germline
|
Institute for Clinical Genetics, University Hospital TU Dresden, University Hospital TU Dresden
Accession: SCV002009995.3
First in ClinVar: Nov 06, 2021 Last updated: Jul 16, 2023 |
|
|
Benign
(Jan 26, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Haddad syndrome
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV000288028.10
First in ClinVar: Jul 01, 2016 Last updated: Feb 20, 2024 |
|
|
Likely benign
(Jan 31, 2019)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV000674213.5
First in ClinVar: Jan 01, 2018 Last updated: May 01, 2024 |
Comment:
This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of … (more)
This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. (less)
|
|
Likely benign
(Feb 01, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: yes
Allele origin:
germline
|
CeGaT Center for Human Genetics Tuebingen
Accession: SCV004150029.5
First in ClinVar: Nov 20, 2023 Last updated: May 12, 2024 |
Comment:
PHOX2B: BS1
Number of individuals with the variant: 18
|
|
Likely benign
(Jan 06, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV000572002.5
First in ClinVar: Oct 02, 2016 Last updated: Sep 25, 2021 |
Comment:
This variant is associated with the following publications: (PMID: 17637745, 14566559)
|
|
Benign
(Oct 26, 2020)
|
criteria provided, single submitter
Method: curation
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Sema4, Sema4
Accession: SCV002535408.1
First in ClinVar: Mar 25, 2020 Last updated: Mar 25, 2020 |
|
|
Likely benign
(-)
|
no assertion criteria provided
Method: clinical testing
|
not provided
Affected status: yes
Allele origin:
germline
|
Genome Diagnostics Laboratory, Amsterdam University Medical Center
Study: VKGL Data-share Consensus
Accession: SCV001808110.1 First in ClinVar: Aug 26, 2021 Last updated: Aug 26, 2021 |
|
|
Likely benign
(-)
|
no assertion criteria provided
Method: clinical testing
|
not provided
Affected status: yes
Allele origin:
germline
|
Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center
Additional submitter:
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen
Study: VKGL Data-share Consensus
Accession: SCV001971336.1 First in ClinVar: Oct 07, 2021 Last updated: Oct 07, 2021 |
|
|
click to load more click to collapse |
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Common PHOX2B poly-alanine contractions impair RET gene transcription, predisposing to Hirschsprung disease. | Di Zanni E | Biochimica et biophysica acta. Molecular basis of disease | 2017 | PMID: 28433712 |
Prevalence and functional consequence of PHOX2B mutations in neuroblastoma. | Raabe EH | Oncogene | 2008 | PMID: 17637745 |
Association between schizophrenia with ocular misalignment and polyalanine length variation in PMX2B. | Toyota T | Human molecular genetics | 2004 | PMID: 14709596 |
Polyalanine expansion and frameshift mutations of the paired-like homeobox gene PHOX2B in congenital central hypoventilation syndrome. | Amiel J | Nature genetics | 2003 | PMID: 12640453 |
Association study of PHOX2B as a candidate gene for Hirschsprung's disease. | Garcia-Barceló M | Gut | 2003 | PMID: 12631670 |
http://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=PHOX2B | - | - | - | - |
Text-mined citations for rs775006915 ...
HelpRecord last updated May 12, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.